View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_52 (Length: 346)
Name: NF0778_low_52
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 326
Target Start/End: Original strand, 7027661 - 7027963
Alignment:
| Q |
19 |
aacagtgttgctactacgcagaagaagacacataacacaagcacaaagaaattggcgttacccattgcacctttctttcaatttgttccattgaaatcaa |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7027661 |
aacagtgttgttactacgcagaagaagacacataacacaagcacaaagaaattggcgttacccattgcacctttctttcaatttgttccattgaaatcaa |
7027760 |
T |
 |
| Q |
119 |
tctcacaatggaaccagcaacttcttcttacaaggtaacaccactttctttctttctttcaatttagggtttccattctccataatcattcaattcgcgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
7027761 |
tctcacaatggaaccagcaacttcttcttacagggtaacaccactttctttctttc----aatttagggtgaa-attttccataatcattcaattcgcgc |
7027855 |
T |
 |
| Q |
219 |
tatttgcagattattttgggttcttcctccgttgcacgccgcaatattttatcccaaatgggataccaattcacattaatggtacattcatttgattgct |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7027856 |
tatttgcagattattttgggttcttcctccgttgcacgccgcaagattttatcccaaatgggataccaattcacattaatggtacattgatttgattgct |
7027955 |
T |
 |
| Q |
319 |
tctatcct |
326 |
Q |
| |
|
|||||||| |
|
|
| T |
7027956 |
tctatcct |
7027963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University