View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_58 (Length: 330)
Name: NF0778_low_58
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 74 - 250
Target Start/End: Complemental strand, 54734531 - 54734357
Alignment:
| Q |
74 |
agcagagatcatgcaaaacttgactggcaataagcaaaccagtcttgtgcggtctcgtctttgcaattgcaattcttctgaataacaaattatcattaat |
173 |
Q |
| |
|
|||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54734531 |
agcacagatcatgcaaaactagactgccaataagcaaaccagtcttgtgcggtctcgtctttgcaattgcaattcttctgaataacaaattatcattaat |
54734432 |
T |
|
| Q |
174 |
gaaaaagatagttcaaaatcttttannnnnnnnaaggaagttaaaaatcttttatttcctttaaatattattgtata |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54734431 |
gaaaaagatagttcaaaatctttt--tttttttaaggaagtccaaaatcttttatttcctttaaatattattgtata |
54734357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 405 times since January 2019
Visitors: 5835