View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_60 (Length: 329)
Name: NF0778_low_60
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_60 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 77 - 235
Target Start/End: Complemental strand, 33624036 - 33623878
Alignment:
| Q |
77 |
agcagcacagaaagagattctagaaacagttgttatgaatcttccaccggaaaagaatctgaattcgtcaacagcaacaaggtttctattcggattgtta |
176 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33624036 |
agcagaacagaaagagatactagaaacagttgttatgaatcttccaccggaaaagaatctgaattcgtcaacagcaacaaggtttctatttggattgtta |
33623937 |
T |
 |
| Q |
177 |
cgaactgcgaatatactaaacgcttcagaatcatgtagaaacgctttggagaagaaaat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33623936 |
cgaactgcgaatatactaaacgcttcagaatcatgtagaaacgctttggagaagaaaat |
33623878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University