View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_61 (Length: 324)
Name: NF0778_low_61
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 7e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 9 - 109
Target Start/End: Original strand, 48518386 - 48518486
Alignment:
| Q |
9 |
atcataggcaaggatgggttctactaagttctaggtggagaaattcaagaacaataatgattccagtctttggagaatgaagatgaggactttcttggtt |
108 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48518386 |
atcaaaggcaaggacgggttctactaagttctaggtggagaaattcaagaacaataatgattccagtctttggagaatgaagatgaggattttcttggtt |
48518485 |
T |
 |
| Q |
109 |
a |
109 |
Q |
| |
|
| |
|
|
| T |
48518486 |
a |
48518486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University