View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_69 (Length: 319)
Name: NF0778_low_69
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 29 - 309
Target Start/End: Original strand, 30504056 - 30504352
Alignment:
| Q |
29 |
acaaagcagaactaaacttgagatcaaagcaatcacannnnnnnattcttatttatcctgtacaaccaacccaatatcttattgtataatctcattctct |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||| ||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30504056 |
acaaagcagaactaaacttgagatcaaagcaatcacatttttttattctcatttttccagtacaaccaacccaatatcttattttataatctcattctct |
30504155 |
T |
 |
| Q |
129 |
atttagatttttaggtactcatgcatcaagaaagtgaaggataatttaattccttcccacacttcaactagtagttgcatgaggggagcattattcatct |
228 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30504156 |
atttagatttttaggtactcatgcaccaaaaaagtgaaggagaatttaattccttcccacacttcaacaagtagttgcatgaggggagcattattcatct |
30504255 |
T |
 |
| Q |
229 |
ttatagaagagacaagttttc----------------cttttattaattattactacttttgtttaaatccctctcttaactcaaccgttctctctg |
309 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30504256 |
ttatagaaaagacaagttttccttttctctatcatcacttttattaattattactacttttgtttaaatccctctcttaactcaaccgttctctctg |
30504352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University