View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_70 (Length: 319)
Name: NF0778_low_70
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_70 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 143 - 310
Target Start/End: Complemental strand, 46507032 - 46506865
Alignment:
| Q |
143 |
caagtttcaatactttgctctctttatatttcatggtttaaatcattcacacattatttcctatttttggttcacatgaggatcttaatcatgggtgtcc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46507032 |
caagtttcaatactttgctctctttatatttcatggtttaaatcattcacacattatttcctatttttggttcacatgaggatcttaatcatgggtgtcc |
46506933 |
T |
|
| Q |
243 |
aaaaataattttgctttagaattttacattaaaatggtgaatatgttggtaacttggtatagtataat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46506932 |
aaaaataattttgctttagaattttacattaaaatgctgaatatgttggtaacttggtatagtataat |
46506865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 37 - 88
Target Start/End: Complemental strand, 46507116 - 46507065
Alignment:
| Q |
37 |
gggtgtttggctgaaatggatgcaccattttattctcatgtttatctcaatc |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46507116 |
gggtgtttggctgaaatggatgcaccattttattctcatgtttatctcaatc |
46507065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 65 times since January 2019
Visitors: 5846