View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_75 (Length: 310)
Name: NF0778_low_75
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 61 - 240
Target Start/End: Complemental strand, 26541521 - 26541342
Alignment:
| Q |
61 |
ttatttaatctgtgattaaaatgagattctaatatgaacctatgtggtcacgtgtagtagcacgacttaatagagttagtgatttaaaggcattgctgaa |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26541521 |
ttatttaatttgtgattaaaatgagattctaatatgaacctatgtggtcacgtgtagtagcacgacttaatagagttagtgatttaaaggcattgctgaa |
26541422 |
T |
 |
| Q |
161 |
attatggaattcatttaagggatggttgtttcttattgtgtggatcggtttcatactttgttgcacataaacctttctct |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26541421 |
attatggaattcatttaagggatggttgtttcttattgtgtggatcggtttcatactctgttgcacataaacctttctct |
26541342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University