View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_76 (Length: 310)
Name: NF0778_low_76
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_76 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 63 - 237
Target Start/End: Complemental strand, 35847914 - 35847741
Alignment:
| Q |
63 |
tgcagcatcagagatcacctatgtaaaataagaaccatgtctattttaattactgtatttagatgaaatgtcaaaaaccaaaatcatactttagaattta |
162 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35847914 |
tgcagcaacagaaatcacctatgtaaaataagaaccatg-ctattttaattactgtatttagatgaaatgtcaaaaatcaaaatcatactttagaattta |
35847816 |
T |
 |
| Q |
163 |
gatggcatataaataaataattattgagaatcagtttgagaccaaacaaggagattgatgaaacattttcccttc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35847815 |
gatggcatataaataaataattattgagaatcagtttgagaccaaacaaggagattgatgaaacatttccccttc |
35847741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University