View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0778_low_76 (Length: 310)

Name: NF0778_low_76
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0778_low_76
NF0778_low_76
[»] chr4 (1 HSPs)
chr4 (63-237)||(35847741-35847914)


Alignment Details
Target: chr4 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 63 - 237
Target Start/End: Complemental strand, 35847914 - 35847741
Alignment:
Q  63 tgcagcatcagagatcacctatgtaaaataagaaccatgtctattttaattactgtatttagatgaaatgtcaaaaaccaaaatcatactttagaattta 162  Q
    ||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  35847914 tgcagcaacagaaatcacctatgtaaaataagaaccatg-ctattttaattactgtatttagatgaaatgtcaaaaatcaaaatcatactttagaattta 35847816  T
Q  163 gatggcatataaataaataattattgagaatcagtttgagaccaaacaaggagattgatgaaacattttcccttc 237  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  35847815 gatggcatataaataaataattattgagaatcagtttgagaccaaacaaggagattgatgaaacatttccccttc 35847741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University