View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_79 (Length: 304)
Name: NF0778_low_79
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_low_79 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 44499644 - 44499851
Alignment:
Q |
1 |
ttaaatgactgagatttttaaataaattttacgtacaaatttaaattaatttatgcacaataaatatttcaaaagtcacatccattaacttctccatgaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44499644 |
ttaaatgactgagatttttaaataaattttacgtacaaatttaaattaatttatgcacaataaatatttcaaaagtcacatccattaacttctccatgaa |
44499743 |
T |
 |
Q |
101 |
taccaataaatttatcagaacttttcttattagttggaaaaaactagtaattatctcagttgctagatactaattcaaaatgatcctatatttcaaatgc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44499744 |
taccaataaatttatcagaacttttcttattagttggaaaaaactagtaattatctcagttgctagatactaattcaaaatgatcctatatttcaaatgc |
44499843 |
T |
 |
Q |
201 |
acgccagc |
208 |
Q |
|
|
|||||||| |
|
|
T |
44499844 |
acgccagc |
44499851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 368 times since January 2019
Visitors: 5835