View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_82 (Length: 295)
Name: NF0778_low_82
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_82 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 99 - 295
Target Start/End: Original strand, 9247739 - 9247935
Alignment:
| Q |
99 |
cctcgtgatcaatcaaggacaatctgtcattgcagccacacatctgacaaactaattttgtttcttcttatgttgcaaaatgcatgtaatgaaaaccttg |
198 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9247739 |
cctcatgatcaatcaaggacaatctgtcattgcagccacgcatctgacaaactaattttgtttcttcttatgttgcaaaatgcatgtaatgaaaaccttg |
9247838 |
T |
 |
| Q |
199 |
cattgtattttaagttggaattgcaaacattgtttttcggtaaccagattccaggtacaaactatctactgccgcttaacagcgtctgatctccgtt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9247839 |
cattgtattttaagttggaattgcaaacattgtttttcagtaaccagattccaggtacaaactatctactgccgcttaacagcgtctgatctccgtt |
9247935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University