View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_83 (Length: 291)
Name: NF0778_low_83
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_83 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 25 - 283
Target Start/End: Original strand, 34330729 - 34330987
Alignment:
| Q |
25 |
agtgatgttatattagtttagtatacttgtaactagaaaagctgagttcagatgaaattgaaatgaatctgagaaaactactaggttgtgttgttggttg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330729 |
agtgatgttatattagtttagtatacttgtaactagaaaagctgagttcagatgaaattgaaatgaatctgagaaaactactaggttgtgttgttggttg |
34330828 |
T |
 |
| Q |
125 |
cttatgaaattccttttgctttcatatatatgtgtttcaggtctgtgtaccaatttgtcctgtcaccaattataaagctgttgaaaccaaacatgtcata |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330829 |
cttatgaaattccttttgctttcatatatatgtgtttcaggtctgtgtaccaatttgtcctgtcaccaattataaagctgttgaaaccaaacatgtcata |
34330928 |
T |
 |
| Q |
225 |
ttctctttaccctaccttttttccttactcttcaatgaaacaaattcccagcctatgat |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34330929 |
ttctctttaccctaccttttttccttactcttcaatgaaacaaattcccagccaatgat |
34330987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University