View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_84 (Length: 291)
Name: NF0778_low_84
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_84 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 70 - 239
Target Start/End: Original strand, 36728707 - 36728875
Alignment:
| Q |
70 |
gttagagatcaagttgtgtattttttgcattccctgacttgccnnnnnnnngcattgatattgactatagactaaatagtaaatgttgacaataaaaatg |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36728707 |
gttagagatcaagttgtgtattttttgcattccctgacttgccaaaaaaa-gcattgatattgactatagactaaatagtaaatgttgacaataaaaatg |
36728805 |
T |
|
| Q |
170 |
ttagtgaggtagatgtgttgctaattcatcttataggtaactaatgtgctttaatttgtgtgggttaaat |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36728806 |
ttagtgaggtagatctgttgctaattcatctcataggtaactaatgtgctttaatttgtgtgggttaaat |
36728875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8 times since January 2019
Visitors: 5846