View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0778_low_84 (Length: 291)

Name: NF0778_low_84
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0778_low_84
NF0778_low_84
[»] chr3 (1 HSPs)
chr3 (70-239)||(36728707-36728875)


Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 70 - 239
Target Start/End: Original strand, 36728707 - 36728875
Alignment:
70 gttagagatcaagttgtgtattttttgcattccctgacttgccnnnnnnnngcattgatattgactatagactaaatagtaaatgttgacaataaaaatg 169  Q
    |||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||    
36728707 gttagagatcaagttgtgtattttttgcattccctgacttgccaaaaaaa-gcattgatattgactatagactaaatagtaaatgttgacaataaaaatg 36728805  T
170 ttagtgaggtagatgtgttgctaattcatcttataggtaactaatgtgctttaatttgtgtgggttaaat 239  Q
    |||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
36728806 ttagtgaggtagatctgttgctaattcatctcataggtaactaatgtgctttaatttgtgtgggttaaat 36728875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 8 times since January 2019
Visitors: 5846