View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_85 (Length: 289)
Name: NF0778_low_85
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_low_85 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 31 - 191
Target Start/End: Original strand, 26543017 - 26543177
Alignment:
Q |
31 |
gtgccaacactgcaaccaaagccattaacataccaaacaccacttttagtgcaaccgaacgagacatgccaaaataaatttcagacccatcatcatgctt |
130 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
26543017 |
gtgccaacactgcaaccaaagccattaacataccaaacaccacttttagtgcaaccgaatgagacatgccaaaataaatttcagaccgatcatcatgctt |
26543116 |
T |
 |
Q |
131 |
cggagaagaagaaggtggttcaatcaaggcagatactgaaatgatcagtatcaaacagaaa |
191 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
26543117 |
cggagaagaataaggtggttcaatcaaggcagatactgaaatgctcagtatcaaacagaaa |
26543177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 426 times since January 2019
Visitors: 5836