View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_86 (Length: 288)
Name: NF0778_low_86
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_86 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 111 - 198
Target Start/End: Complemental strand, 26542917 - 26542830
Alignment:
| Q |
111 |
cattgtagtataagaagacactgtcatattattatatgannnnnnnnaggggatttggtgctatgtatgttcatctttgtttgatgat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26542917 |
cattgtagtataagaagacactgtcatattattatatgattttttttaggggatttggtgctatgtatgttcatctttgtttgatgat |
26542830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 15 - 82
Target Start/End: Complemental strand, 26543016 - 26542947
Alignment:
| Q |
15 |
tggtaatgctcgatcttctacaatgtcctctacacagcttcaatcacaaagtgat--tactcatgtttag |
82 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26543016 |
tggtaatgctcgatcttctacaatgtccgctacgcagcttcaatcacaaagtgatgctactcatgtttag |
26542947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 466 times since January 2019
Visitors: 5838