View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_88 (Length: 287)
Name: NF0778_low_88
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_88 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 47 - 223
Target Start/End: Complemental strand, 39270018 - 39269842
Alignment:
| Q |
47 |
cacagaggttgtgactgctggcaatcatctttgcccttcaattggagcctccgaggtttctagatttccggttgggttcatgacgcgttttgaactcttt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
39270018 |
cacagaggttgtgactgctggcaatcatctttgcccttcaattggagcctccgaggtttctagatttccggttgggtacatgacccgttttgaactcttt |
39269919 |
T |
 |
| Q |
147 |
aacgtaaatgtttcaatcaatcgtcatcatcatcactaacacatatataattgtattgatatgtgtatagtgtaatg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39269918 |
aacgtaaatgtttcaatcaatcgtcatcatcatcactaacacatatataattgtattgatatatgtatagtgtaatg |
39269842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University