View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_90 (Length: 282)
Name: NF0778_low_90
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_low_90 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 28 - 271
Target Start/End: Original strand, 10599248 - 10599491
Alignment:
Q |
28 |
acatcaaaacacttgcgagcaccttccattctcccagaccttgcatacacactaacaagaccattccctacacaatcaatcgcagaaagacctaatttaa |
127 |
Q |
|
|
||||||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
10599248 |
acatcaaaacacttgcgagcagattccattcttccagactttgcatacacactaacaagaccattccctacacaatcaattgcagaaagacctaatttaa |
10599347 |
T |
 |
Q |
128 |
tcgtttgcccgtgaacttgttcaccaaaatcaaaattaggaagactcgcacaagccttaagaacaccagaaaacgtaaagcaatttggcgcaacacaacc |
227 |
Q |
|
|
|||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||||||| || |||||||||| ||| |
|
|
T |
10599348 |
tcgtttgcccatgaacctgttcaccaaaatcaaaatcaggaagactcgcacaagccttaagaacaccggagaacgtaaagcagttcggcgcaacaccacc |
10599447 |
T |
 |
Q |
228 |
ctgaagcaacatatcgctaaacaatctcatagcttcccgttcat |
271 |
Q |
|
|
|||||||||||||| ||||||| |||||||||||||||||||| |
|
|
T |
10599448 |
ctgaagcaacatattactaaacattctcatagcttcccgttcat |
10599491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 7 - 36
Target Start/End: Complemental strand, 51815058 - 51815029
Alignment:
Q |
7 |
ggattggcataaaggaaaagtacatcaaaa |
36 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
51815058 |
ggattggcataaaggaaaagtacatcaaaa |
51815029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University