View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0778_low_92 (Length: 280)

Name: NF0778_low_92
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0778_low_92
NF0778_low_92
[»] chr1 (1 HSPs)
chr1 (58-189)||(44393505-44393642)
[»] chr8 (1 HSPs)
chr8 (57-146)||(40713252-40713338)


Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 58 - 189
Target Start/End: Original strand, 44393505 - 44393642
Alignment:
58 atgcaatttgaagggtcttaccgtatagga------ggtagtgctaggatcagtgagaagattggcttgagtgaaattgcagagattgaaggctttctgg 151  Q
    ||||||||||||||||||||||||||||||      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44393505 atgcaatttgaagggtcttaccgtataggagcaggaggtagtgctaggatcagtgagaagattggcttgagtgaaattgcagagattgaaggctttctgg 44393604  T
152 ttcttgaaaatgtagaggttgtagttttgcttgtgctt 189  Q
    ||||||||||||||||||||||||||||||||||||||    
44393605 ttcttgaaaatgtagaggttgtagttttgcttgtgctt 44393642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 57 - 146
Target Start/End: Complemental strand, 40713338 - 40713252
Alignment:
57 tatgcaatttgaagggtcttaccgtataggaggtagtgctaggatcagtgagaagattggcttgagtgaaattgcagagattgaaggctt 146  Q
    |||| ||||||||||||||||| || |||||||||||| | || |  ||||| | ||||||||| ||||||||   ||||||||||||||    
40713338 tatgaaatttgaagggtcttacagtgtaggaggtagtgttggggttggtgagcatattggcttgcgtgaaatt---gagattgaaggctt 40713252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University