View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_92 (Length: 280)
Name: NF0778_low_92
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_low_92 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 58 - 189
Target Start/End: Original strand, 44393505 - 44393642
Alignment:
Q |
58 |
atgcaatttgaagggtcttaccgtatagga------ggtagtgctaggatcagtgagaagattggcttgagtgaaattgcagagattgaaggctttctgg |
151 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44393505 |
atgcaatttgaagggtcttaccgtataggagcaggaggtagtgctaggatcagtgagaagattggcttgagtgaaattgcagagattgaaggctttctgg |
44393604 |
T |
 |
Q |
152 |
ttcttgaaaatgtagaggttgtagttttgcttgtgctt |
189 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
44393605 |
ttcttgaaaatgtagaggttgtagttttgcttgtgctt |
44393642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 57 - 146
Target Start/End: Complemental strand, 40713338 - 40713252
Alignment:
Q |
57 |
tatgcaatttgaagggtcttaccgtataggaggtagtgctaggatcagtgagaagattggcttgagtgaaattgcagagattgaaggctt |
146 |
Q |
|
|
|||| ||||||||||||||||| || |||||||||||| | || | ||||| | ||||||||| |||||||| |||||||||||||| |
|
|
T |
40713338 |
tatgaaatttgaagggtcttacagtgtaggaggtagtgttggggttggtgagcatattggcttgcgtgaaatt---gagattgaaggctt |
40713252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University