View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_98 (Length: 267)
Name: NF0778_low_98
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_low_98 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 34 - 220
Target Start/End: Complemental strand, 31273300 - 31273114
Alignment:
Q |
34 |
tagaaggcggttatattaagatttgagaaagagaagaataaacgtccatgtggcaaactcaaacaagtgtaggcattgtatttttgtgagcaacgaccgc |
133 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31273300 |
tagaaggcggttatattaagatttgagaaagagaagaataaatgtccatgtggcaaactcaaacaagtgtaggcattgtatttttgtgagcaacgaccgc |
31273201 |
T |
 |
Q |
134 |
caaagctttctatatatatacacctctaaatgatgctaacatgcttttcaggcacaaaacattgactcaaaatcaacactgctgtta |
220 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31273200 |
caaagctttctatatatatacacctctaaatgatgctaacatgcttttcaggcacaaaacattgactcaaaatcaacactgctgtta |
31273114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 316 times since January 2019
Visitors: 5834