View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0779_low_10 (Length: 394)
Name: NF0779_low_10
Description: NF0779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0779_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 214 - 312
Target Start/End: Original strand, 33175946 - 33176044
Alignment:
| Q |
214 |
ggaatcactcaattgtggatataaaatggtgcggatgaagaaaaccatgacaaataacaagtgtaaaatagagcatcaaaggtaagtgcagtatattgt |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
33175946 |
ggaatcactcaattgtggatataaaatggtgcgaataaagaaaaccatgacaaataacaagtgtaaaacagagcatcaaaggtaagtgtagtatattgt |
33176044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 123 - 185
Target Start/End: Original strand, 33175847 - 33175909
Alignment:
| Q |
123 |
aatatagtattaggttttgctcataattttgtttgaagggttcaaccttaaacaaacaacttg |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33175847 |
aatatagtattaggttttgctcataattttgtttgaagggttcaaccttaaacaaagaacttg |
33175909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 172 times since January 2019
Visitors: 5832