View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0779_low_15 (Length: 289)
Name: NF0779_low_15
Description: NF0779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0779_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 32 - 223
Target Start/End: Complemental strand, 34036082 - 34035891
Alignment:
| Q |
32 |
gggcgacacttttctcccatcaagatgttcttcctccaaagaacttcttcttcttggtttccttcttccaatactccttcagcctgcacttttctccaag |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34036082 |
gggcgacacttttctcccatcaagatgttcttcctccaaagaacttcttcttcttggtttccttcttccaatcctccttcagcctgcacttttctccaag |
34035983 |
T |
|
| Q |
132 |
atagcatcctcaccattgaaatagctctggtgctaattttactgtttagcttcgaaattagcttagtttccttggtcgaagacaccgttgct |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34035982 |
atagcatcctcaccattgaaatagctctggtgctaattttactgtttagcttcgaaattagcttagtttccttggtcgaagacaccgttgct |
34035891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 164 times since January 2019
Visitors: 5832