View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0779_low_29 (Length: 205)
Name: NF0779_low_29
Description: NF0779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0779_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 36467778 - 36467903
Alignment:
| Q |
1 |
gttattctaatgggaacattattatgcgtcaattagtatgcaaaaagaagaatgcattgtaactatttggatgtctgctgtatggttatgtggattggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36467778 |
gttattctaatgggaacattattatgcgtcaattagtatgcaaaaagaagaatgcattgtaactatttggatgtctgctgtatggttatgtggattggtt |
36467877 |
T |
|
| Q |
101 |
gtgtgcgttttctacttggatctgtg |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36467878 |
gtgtgcgttttctacttggatctgtg |
36467903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 77 times since January 2019
Visitors: 5830