View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0779_low_30 (Length: 204)
Name: NF0779_low_30
Description: NF0779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0779_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 42750131 - 42750008
Alignment:
| Q |
1 |
ggtaaatcattgttggaaagccatctagacctggtgaagccaaactttacatttgactagttaaatgagcttggaggatattctgcatgttaggaacttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42750131 |
ggtaaatcattgttggaaagccatctagacctggtgaagccaaactttacatttgactagttaaatgagcttggaggatattctgcatgttaggaacttt |
42750032 |
T |
 |
| Q |
101 |
atctttcaccacagcctttgtttc |
124 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
42750031 |
atctttcaccacagccattgtttc |
42750008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University