View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0779_low_5 (Length: 486)
Name: NF0779_low_5
Description: NF0779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0779_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 57 - 466
Target Start/End: Original strand, 52016708 - 52017117
Alignment:
| Q |
57 |
tcattctttttgccaaggagttttttacaatgtcattcttcttgtcagcaagttttacattgccaagcctttcttgtattggacttttaaagagttaaat |
156 |
Q |
| |
|
|||||||||||| ||| |||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52016708 |
tcattctttttgtcaatgagttttt-acattgtcattcttcttgtcagcaagttttacattgtcaagcctttcttgtattggacttttgaagagttaaat |
52016806 |
T |
|
| Q |
157 |
tttgcccttctattttcacagctttgctaattgtgagctgcgttccgtggtcatcattgatagggggtgagcatccatcctatttacagaataacttata |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52016807 |
tttgcccttctattttcacagctttgctaattgtgagctgcgttccgtggtcatcattgatagggggtgagcatccatcctatttacagaataacttata |
52016906 |
T |
|
| Q |
257 |
ctcattactcaaacttctgcacaaaattcagttttgtgtattcatttttacaggacgattggatcagatgagtcctctaccaactttcctggcaaaattc |
356 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52016907 |
ctcagtactcaaacttctgcacaaaattcag--ttgtgtattcatttttacaggacgattggatcagatgagtcctctaccaactttcctggcaaaattc |
52017004 |
T |
|
| Q |
357 |
cacagggccttgaccttcccagtgatgttgctgacgagaaactttctggaagtgggccatcaaagtaac---atgatgagcttttctcctgtcaacattt |
453 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52017005 |
cacagggccttgaccttcccagtgatgttgctgacgagaaactttctgggagtgggccatcaaagtaacatgatgatgagcttttctcctgtcaacattt |
52017104 |
T |
|
| Q |
454 |
caagatgatgatg |
466 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52017105 |
caagatgatgatg |
52017117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1032 times since January 2019
Visitors: 5823