View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_high_19 (Length: 253)
Name: NF0780_high_19
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 3110134 - 3110098
Alignment:
| Q |
8 |
aagtaaataaataattgcttctcacttgtaattactc |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3110134 |
aagtaaataaataattgcttctcacttgtaattactc |
3110098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6711 times since January 2019
Visitors: 5770