View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_100 (Length: 211)
Name: NF0780_low_100
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_100 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 9e-63; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 45273825 - 45273950
Alignment:
Q |
1 |
ttgctaaatacttccatggtctgcccaagtaagaccgaattgtgaatctttctgggaacaatgctgcttctgggatgatattgcaatcctggatcacaat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45273825 |
ttgctaaatacttccatggtctgcccaagtaagaccgaattgtgaatctttctgggaacaatgctgcttctgggatgatattgcaatcctggatcacaat |
45273924 |
T |
 |
Q |
101 |
accagtattcaaattcatcgtctctg |
126 |
Q |
|
|
||||||||||||||||||||| |||| |
|
|
T |
45273925 |
accagtattcaaattcatcgtgtctg |
45273950 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 45282069 - 45282194
Alignment:
Q |
1 |
ttgctaaatacttccatggtctgcccaagtaagaccgaattgtgaatctttctgggaacaatgctgcttctgggatgatattgcaatcctggatcacaat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45282069 |
ttgctaaatacttccatggtctgcccaagtaagaccgaattgtgaatctttctgggaacaatgctgcttctgggatgatattgcaatcctggatcacaat |
45282168 |
T |
 |
Q |
101 |
accagtattcaaattcatcgtctctg |
126 |
Q |
|
|
||||||||||||||||||||| |||| |
|
|
T |
45282169 |
accagtattcaaattcatcgtgtctg |
45282194 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 14 - 117
Target Start/End: Original strand, 45270306 - 45270409
Alignment:
Q |
14 |
ccatggtctgcccaagtaagaccgaattgtgaatctttctgggaacaatgctgcttctgggatgatattgcaatcctggatcacaataccagtattcaaa |
113 |
Q |
|
|
||||||||||||||||||||||| || ||||||| |||| |||| ||||||||||||||||||||||||||| |||||||| |||||||||||||||| | |
|
|
T |
45270306 |
ccatggtctgcccaagtaagacctaactgtgaatttttcagggaccaatgctgcttctgggatgatattgcagtcctggataacaataccagtattcata |
45270405 |
T |
 |
Q |
114 |
ttca |
117 |
Q |
|
|
|||| |
|
|
T |
45270406 |
ttca |
45270409 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 45293409 - 45293520
Alignment:
Q |
1 |
ttgctaaatacttccatggtctgcccaagtaagaccgaattgtgaatctttctgggaacaatgctgcttctgggatgatattgcaatcctggatcacaat |
100 |
Q |
|
|
|||||||| |||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||| | ||||||||||| |
|
|
T |
45293409 |
ttgctaaaaccttccatggtctgcccaagtaagatttaattgtgaatctttgagggaacaatgctgcttctgggacaatattgcagccttggatcacaat |
45293508 |
T |
 |
Q |
101 |
accagtattcaa |
112 |
Q |
|
|
|||||||||||| |
|
|
T |
45293509 |
accagtattcaa |
45293520 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 45302369 - 45302480
Alignment:
Q |
1 |
ttgctaaatacttccatggtctgcccaagtaagaccgaattgtgaatctttctgggaacaatgctgcttctgggatgatattgcaatcctggatcacaat |
100 |
Q |
|
|
|||||||| |||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||| | ||||||||||| |
|
|
T |
45302369 |
ttgctaaaaccttccatggtctgcccaagtaagatttaattgtgaatctttgagggaacaatgctgcttctgggacaatattgcagccttggatcacaat |
45302468 |
T |
 |
Q |
101 |
accagtattcaa |
112 |
Q |
|
|
|||||||||||| |
|
|
T |
45302469 |
accagtattcaa |
45302480 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University