View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_102 (Length: 209)
Name: NF0780_low_102
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_102 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 16 - 134
Target Start/End: Complemental strand, 20523632 - 20523514
Alignment:
Q |
16 |
taacaaggaatagttatttaatggcacattatagcttttaaatacgacccttcctcaactcttctataacctgtaattttcttcatccctttctcttctg |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20523632 |
taacaaggaatagttatttaatggcacattatagcttttaaatacgacccttcctcaactcttctataacctgtaattttcttcatccctttctcttctg |
20523533 |
T |
 |
Q |
116 |
tgcctgttacctttgtttc |
134 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
20523532 |
tgcctgttacctttgtttc |
20523514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7067 times since January 2019
Visitors: 5773