View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_103 (Length: 207)
Name: NF0780_low_103
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_103 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 1915548 - 1915442
Alignment:
| Q |
1 |
cttcagacaacaaatccaaccacacctacacttccaaaaccaacattgc---cacctttgccaacaatccctgcagcattgccaaaacctactcagccat |
97 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1915548 |
cttcagacaacaaatccaactacacctacacttccaaaaccaacattgctgccacctttgccaacaatccctgcagcattgccaaaacctactcagccat |
1915449 |
T |
|
| Q |
98 |
ctattcc |
104 |
Q |
| |
|
||||||| |
|
|
| T |
1915448 |
ctattcc |
1915442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5002 times since January 2019
Visitors: 5753