View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_106 (Length: 204)
Name: NF0780_low_106
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_106 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 5e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 10187472 - 10187590
Alignment:
Q |
1 |
ccgagatgtacgttctactcctgtggtttttattctacttttttctgcctgcattttgttctttattaagcattctgcatgttgcctcggggcccttaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10187472 |
ccgagatgtacgttctactcctgtggtttttattctacttttttctgcctgcattttgttctttattaagcattctgcatgttgcctcggggcccttaaa |
10187571 |
T |
 |
Q |
101 |
aaatgttggtgttctgtgc |
119 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
10187572 |
aaatgttggtgttctgtgc |
10187590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 42 - 120
Target Start/End: Original strand, 28933230 - 28933308
Alignment:
Q |
42 |
tttctgcctgcattttgttctttattaagcattctgcatgttgcctcggggcccttaaaaaatgttggtgttctgtgct |
120 |
Q |
|
|
||||| ||||||||||||||| ||||| | |||||||| ||| |||| || ||| |||||||| |||||||| |||||| |
|
|
T |
28933230 |
tttctacctgcattttgttctatattatgtattctgcaggtttcctcaggccccataaaaaatattggtgttgtgtgct |
28933308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University