View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_107 (Length: 204)

Name: NF0780_low_107
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_107
NF0780_low_107
[»] chr4 (1 HSPs)
chr4 (1-116)||(42750016-42750131)


Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 42750131 - 42750016
Alignment:
1 ggtaaatcattgttggaaagccatctagacctggtgaagccaaactttacatttgactagttaaatgagcttggaggatattctgcatgttaggaacttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42750131 ggtaaatcattgttggaaagccatctagacctggtgaagccaaactttacatttgactagttaaatgagcttggaggatattctgcatgttaggaacttt 42750032  T
101 atctttcaccacagcc 116  Q
    ||||||||||||||||    
42750031 atctttcaccacagcc 42750016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6767 times since January 2019
Visitors: 5771