View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_110 (Length: 202)
Name: NF0780_low_110
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_110 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 3 - 117
Target Start/End: Original strand, 39298724 - 39298838
Alignment:
Q |
3 |
tcacgccatgattcatctttcttcttagcagtaaactccttagcagtctcgccagcagaagcagccaaacctttcacaacatccaccgatttcgacgcaa |
102 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
39298724 |
tcacgccatgattcatctttcttcttagcagtaaactccttagcagtctcaccagcagaagcagccaaacctttcacaacatccaccgatttcaacgcaa |
39298823 |
T |
 |
Q |
103 |
gctcggccgcctttg |
117 |
Q |
|
|
|| |||||||||||| |
|
|
T |
39298824 |
gcccggccgcctttg |
39298838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6940 times since January 2019
Visitors: 5773