View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_110 (Length: 202)

Name: NF0780_low_110
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_110
NF0780_low_110
[»] chr2 (1 HSPs)
chr2 (3-117)||(39298724-39298838)


Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 3 - 117
Target Start/End: Original strand, 39298724 - 39298838
Alignment:
3 tcacgccatgattcatctttcttcttagcagtaaactccttagcagtctcgccagcagaagcagccaaacctttcacaacatccaccgatttcgacgcaa 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||    
39298724 tcacgccatgattcatctttcttcttagcagtaaactccttagcagtctcaccagcagaagcagccaaacctttcacaacatccaccgatttcaacgcaa 39298823  T
103 gctcggccgcctttg 117  Q
    || ||||||||||||    
39298824 gcccggccgcctttg 39298838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6940 times since January 2019
Visitors: 5773