View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_111 (Length: 202)

Name: NF0780_low_111
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_111
NF0780_low_111
[»] chr2 (1 HSPs)
chr2 (1-121)||(24860279-24860399)


Alignment Details
Target: chr2 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 24860399 - 24860279
Alignment:
1 tacattgcatgggacatctctggtggacatgtcaatcctgctgtgacctttgcaatggctgtgggaggacatattagtgtcccaactgctctcttttatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24860399 tacattgcatgggacatctctggtggacatgtcaatcctgctgtgacctttgcaatggctgtgggaggacatattagtgtcccaactgctctcttttatt 24860300  T
101 gggttgctcaacttattgcct 121  Q
    |||||||||||||||||||||    
24860299 gggttgctcaacttattgcct 24860279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University