View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_113 (Length: 201)
Name: NF0780_low_113
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_113 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 38096037 - 38096208
Alignment:
Q |
1 |
ttaacttgagtgataaacaaccaattcaacaacatccagaacagaatttcacaagttatagaaattcaaagagcaaggtaacaactttaagtggaaattg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
38096037 |
ttaacttgagtgataaacaaccaattcaacaacatccagaacagaatttcacaagttatagaaattcaaagatcaaggtaacaactttaagtggaaattg |
38096136 |
T |
 |
Q |
101 |
tcaacagaaattagagagtaatgaagatcaatatgaagaatatgaagaggaattattaggagatggagagaa |
172 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38096137 |
tcaacagaaattagagagtaatgaagatcaatatgaagaatatgaagaggaattattaggagatggagagaa |
38096208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University