View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_13 (Length: 404)
Name: NF0780_low_13
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 95 - 398
Target Start/End: Original strand, 30315004 - 30315305
Alignment:
| Q |
95 |
gattgttggtgttgcaagaatcatagtcttctttcttcaccacaagaaccgaatcattccctttaacgtacttgaaatctgcagcatttttcaaaataat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30315004 |
gattgttggtgttgcaagaatcatagtcttctttcttcaccacaagaaccgaatcattccctttaacgtacttgaaatctgcaacatttttcaaaataaa |
30315103 |
T |
|
| Q |
195 |
aacaacgttacaagttattaaaagagtatataataataaataatactcgtaaaatgattgtaatgttggggattaacaatgaatattggactcacggaga |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
30315104 |
aacaacgttacaagttattaaaagagtatataataataaataatactcgtaaaatgattgtaatgttgaggattaacaatga--attggactcacggaga |
30315201 |
T |
|
| Q |
295 |
gtgtcattgactcgaaatctatgtgttcgagcccactgattgtagtcttcagaaggattcacgacccaaccatctttgccaccaacatgaaactcctttg |
394 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30315202 |
gtgtcattgactcgaaacctatgtgttcgagcccactgattgtagtcttcagaaggattcacgacccaaccatctttgccaccaacatgaaactcctttg |
30315301 |
T |
|
| Q |
395 |
cttc |
398 |
Q |
| |
|
|||| |
|
|
| T |
30315302 |
cttc |
30315305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6612 times since January 2019
Visitors: 5769