View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_17 (Length: 389)
Name: NF0780_low_17
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 46344091 - 46343890
Alignment:
| Q |
1 |
ttctaaccctacatattctaaatgcatgttttgaattgtggtagactattttgttaaagcttcaaagtgtaatttttgtaaaatctctggtaattagtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46344091 |
ttctaaccctacatattctaaatgcatgttttgaattgtggtagactattttgttaaagcttcaaagtgtaatttttgtaaaatctctggtaattagtga |
46343992 |
T |
|
| Q |
101 |
ttttgtcaaatagagtcctaacataaacttattgctgtcaactatatcaatcgactttcatgtcactaaactagtcaccaaacataaaagtaatcaaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46343991 |
ttttgtcaaatagagtcctaacataaacttattgttgtcaactatatcaatcgactttcatgtcactaaactagtcaccaaacataaaagtaatcaaatc |
46343892 |
T |
|
| Q |
201 |
ag |
202 |
Q |
| |
|
|| |
|
|
| T |
46343891 |
ag |
46343890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6102 times since January 2019
Visitors: 5762