View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_20 (Length: 369)
Name: NF0780_low_20
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_20 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 67 - 369
Target Start/End: Complemental strand, 55080874 - 55080572
Alignment:
Q |
67 |
tcacacccaactcatttccacatacacttcatgctttccaagtaacaatcttcaaacacttaccaatagtttcttcaaatgcatgaattccaccaaccca |
166 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55080874 |
tcacacccaactcatttccacatacacttcattctttccaagcaacaatcttcaaacacttaccaatagtttcttcaaatgcatgaattccaccaaccca |
55080775 |
T |
 |
Q |
167 |
ttacatttcaatgtcatcatatctcatttctgtcgtaaaggtttcccctttcttgctctcaccaccttttcctttatgcacaccaatcacgttcctttgg |
266 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55080774 |
ttacatttcaatgtcatcatatctcatttctgtcgtaaaggtttcccctttcttgctctcaccaccttttcctttatgcacaccaatcacgttcctttgg |
55080675 |
T |
 |
Q |
267 |
atacatactctttgtgtagcactttgaccgcttcatctaaattcaaagacatcaattttgggaaacagatacatgcccacgttgaaaaatcaggttggtc |
366 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55080674 |
atacatacgctttgtgtagcactttgaccgcttcatctaaattcaaagacgtcaattttgggaaacagatacatgcccacgttgaaaaatcaggttggtc |
55080575 |
T |
 |
Q |
367 |
ttc |
369 |
Q |
|
|
||| |
|
|
T |
55080574 |
ttc |
55080572 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University