View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_24 (Length: 346)
Name: NF0780_low_24
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 184 - 252
Target Start/End: Original strand, 275284 - 275356
Alignment:
| Q |
184 |
taaaaactcttaaagctgacagtgtatatgaattaaagcc----ataaattataacaagagaattatatacct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
275284 |
taaaaactcttaaagctgacagtgtatatgaattaaacccataaataaattataacaagagaattatatacct |
275356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5343 times since January 2019
Visitors: 5756