View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_27 (Length: 331)
Name: NF0780_low_27
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 1e-66; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 99 - 235
Target Start/End: Complemental strand, 26805402 - 26805266
Alignment:
| Q |
99 |
gttggaagcaccggcatcggcggtgcagaggcagatggttgtggttgataaggataggccatgatgatagcgatgatatgaatgttatgttttgttatga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26805402 |
gttggaagcaccggcatcggcggtgcagaggcagatggttgtggttgataaggataagccatgatgatagtgatgatatgaatgttatgttttgttatga |
26805303 |
T |
 |
| Q |
199 |
acttatgatagctctttaattttaatttgtctctgtg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26805302 |
acttatgatagctctttaattttaatttgtctctgtg |
26805266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 99 - 160
Target Start/End: Complemental strand, 26824227 - 26824166
Alignment:
| Q |
99 |
gttggaagcaccggcatcggcggtgcagaggcagatggttgtggttgataaggataggccat |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
26824227 |
gttggaagcaccggcatcggcggtgcagaggcagatggttgtggttgacaaggataagccat |
26824166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 120 - 167
Target Start/End: Complemental strand, 26824134 - 26824087
Alignment:
| Q |
120 |
ggtgcagaggcagatggttgtggttgataaggataggccatgatgata |
167 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
26824134 |
ggtgcagaggcagaaggttgtggttgataaggataagccatgatgata |
26824087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 119 - 168
Target Start/End: Complemental strand, 26836085 - 26836036
Alignment:
| Q |
119 |
cggtgcagaggcagatggttgtggttgataaggataggccatgatgatag |
168 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
26836085 |
cggtgcagaggaagaaggttgtggttgataaggataagccatgatgatag |
26836036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 109 - 165
Target Start/End: Complemental strand, 26800290 - 26800234
Alignment:
| Q |
109 |
ccggcatcggcggtgcagaggcagatggttgtggttgataaggataggccatgatga |
165 |
Q |
| |
|
||||||||||||||||||| ||| || | ||||||||||||||||| ||||| |||| |
|
|
| T |
26800290 |
ccggcatcggcggtgcagaagcatattgctgtggttgataaggataagccataatga |
26800234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University