View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_30 (Length: 329)
Name: NF0780_low_30
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_30 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 14 - 329
Target Start/End: Complemental strand, 45652913 - 45652581
Alignment:
| Q |
14 |
gtttccaaaattctttgtgtaccggagaagatatgaccacaaatctgggttgtaaaaatagaacttactctctcttcttatctcgtgtctactagaacnn |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45652913 |
gtttccaaaattctttgtgtaccggaaaagatagaaccaaaaatctgggttgtaaaaatagaacttactttctcttcttatctcgtgtctactagaactt |
45652814 |
T |
|
| Q |
114 |
nnnnnnnnaaaatgtgttagnnnnnnnnnnnnnttgagcattttaatttgtatatatgaggggaaaatggacagtttagtcaaaatatatggggtgaggg |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45652813 |
gtttttg-aaaatgtgttagaaaaagtaaaaaattgagcattttaatttgtatatatgagggcaaaatggacagtttagtcaaaatatatggggtgaggg |
45652715 |
T |
|
| Q |
214 |
t--ataattgtaggtggtacaagaa----------------tgtattgctttagaagcccacttcagatatattgcaatgggggaggagagtgttgaagt |
295 |
Q |
| |
|
| |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45652714 |
tgtataattgtaggtggtacaagaaaatattttcacaagaatgtattgctttagaggcccacttcagatatattgcaatgggggaggagagtgttgaagt |
45652615 |
T |
|
| Q |
296 |
aaattggttgttatggtttgttgtcaactactac |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45652614 |
aaattggttgttatggtttgttgtcaactactac |
45652581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7157 times since January 2019
Visitors: 5774