View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_32 (Length: 325)
Name: NF0780_low_32
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 5e-90; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 14 - 193
Target Start/End: Complemental strand, 6206501 - 6206322
Alignment:
Q |
14 |
gatgaagaagacagtacttcaagcattgcacttcccaagttgaccaaattgttgttgtgggatttaccacaattgaagatcgtgtgcaaaggcaggatac |
113 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6206501 |
gatgaagaagacagtacttcaagcattgcacttcccaagttgaccaaattgttgttgtgggatttaccacaattgaagatcgtgtgcaaaggcaggatac |
6206402 |
T |
 |
Q |
114 |
actatggaacttcaccaccgaaactgattattaacctatgtccgagattagaaaaacatcctacaatttggaactgattc |
193 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
T |
6206401 |
actatggaacttcaccaccgaaactggttattaacctatgtccgagattagataaacatcctacaatttgaaactgattc |
6206322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 14 - 171
Target Start/End: Complemental strand, 6232919 - 6232762
Alignment:
Q |
14 |
gatgaagaagacagtacttcaagcattgcacttcccaagttgaccaaattgttgttgtgggatttaccacaattgaagatcgtgtgcaaaggcaggatac |
113 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
6232919 |
gatgacgaagacagtacttcaagcattgcacttcccaagttgaccaaattattgttgtgggatttaccacaattgaagatcgtgtgcaaaggcagtatac |
6232820 |
T |
 |
Q |
114 |
actatggaacttcaccaccgaaactgattattaacctatgtccgagattagaaaaaca |
171 |
Q |
|
|
|| ||||||||| | |||||||||| ||||||||||||||||||||||||| ||||| |
|
|
T |
6232819 |
gctgtggaacttctctaccgaaactggttattaacctatgtccgagattagataaaca |
6232762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 75 - 113
Target Start/End: Complemental strand, 6104027 - 6103989
Alignment:
Q |
75 |
atttaccacaattgaagatcgtgtgcaaaggcaggatac |
113 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
T |
6104027 |
atttaccacaattgaagatcgtgtgcaaaggcagcatac |
6103989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 35 - 131
Target Start/End: Complemental strand, 6087359 - 6087263
Alignment:
Q |
35 |
agcattgcacttcccaagttgaccaaattgttgttgtgggatttaccacaattgaagatcgtgtgcaaaggcaggatacactatggaacttcaccac |
131 |
Q |
|
|
|||||| ||||||| |||||||| | |||| ||||| ||||||||||||||||||| || | ||||||||| |||| || |||| ||||||||| |
|
|
T |
6087359 |
agcattacacttccgaagttgacgacattggagttgtacaatttaccacaattgaagattgtttacaaaggcagtatacgctgtggatcttcaccac |
6087263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 34 - 105
Target Start/End: Complemental strand, 6092730 - 6092659
Alignment:
Q |
34 |
aagcattgcacttcccaagttgaccaaattgttgttgtgggatttaccacaattgaagatcgtgtgcaaagg |
105 |
Q |
|
|
|||||||||| ||||||||||||||| || |||| | |||||||||||| ||||||| ||||||||||| |
|
|
T |
6092730 |
aagcattgcatttcccaagttgaccagtttagagttgggagatttaccacaactgaagattgtgtgcaaagg |
6092659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5420 times since January 2019
Visitors: 5757