View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_35 (Length: 323)
Name: NF0780_low_35
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_35 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 103 - 323
Target Start/End: Original strand, 7445082 - 7445302
Alignment:
| Q |
103 |
ctttctctacttgtgtgtatgatggtgatcttcgtggacagatgcatggaccgaaaaggaaataaattgtgatataccaattaggttgtgttctgagttc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7445082 |
ctttctctacttgtgtgtatgatggtgatcttcgtggacagatgcatggaccgaaaaggaaataaattgtgatataccaattaggttgtgttctgagttc |
7445181 |
T |
|
| Q |
203 |
tcacgttctcccacatgttctcaatcatgcacatattgctggaatcagattccccttccacttttattaattaatcaattcttcttacttaagttcctag |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7445182 |
tcacgttctcccacatgttctcaatcatgcacatattgctggaatcagattccccttccacttttattaattaatcaattcttcttacttaagttcctag |
7445281 |
T |
|
| Q |
303 |
ggcaaaccctatacataaaac |
323 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7445282 |
ggcaaaccctatacataaaac |
7445302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7047 times since January 2019
Visitors: 5773