View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_37 (Length: 320)
Name: NF0780_low_37
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 3 - 203
Target Start/End: Original strand, 44285691 - 44285890
Alignment:
| Q |
3 |
gcatttcttgctagttcttctcccagtctcggactcagccttttagccgattcgcacctttactctctgtctcaatcgagccggtcagatcaatagagaa |
102 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
44285691 |
gcatttcttgctagttcttctcccaatctcggactcgaccttttagccgattcgcacctttactctctgtctcaatcaattcggtcagatcaatagagaa |
44285790 |
T |
|
| Q |
103 |
gtcaggcactcgatagacttaaaggaaggttccgcccgtaaatttcttgatcaatgttaccgggaagcagcaacagagacagattgagtgctaaagcttc |
202 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
44285791 |
gtcaggcactcgattgacttaaaggaagattccg-ccgtaaattgattgatcaatgttaccgggaagcagcaacagagatggattgagtactaaagcttc |
44285889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 3 - 200
Target Start/End: Complemental strand, 44070322 - 44070126
Alignment:
| Q |
3 |
gcatttcttgctagttcttctcccagtctcggactcagccttttagccgattcgcacctttactctctgtctcaatcgagccggtcagatcaatagagaa |
102 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |||||||| || |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44070322 |
gcatttcttgctagttcttctcccaatctcggactcagccgtttagccggtttgcacctttactctctgtctcaatctagccggtcagatcaatagagaa |
44070223 |
T |
|
| Q |
103 |
gtcaggcactcgatagacttaaaggaaggttccgcccgtaaatttcttgatcaatgttaccgggaagcagcaacagagacagattgagtgctaaagct |
200 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||| |||| |||| ||||| ||||| || ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44070222 |
gtcaggcacttgattgacttaaaggaaggttccg-ccgttaattgattgattgatgttgccaggaagcagcaacagagacagattgagtactaaagct |
44070126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 105 - 200
Target Start/End: Complemental strand, 16443843 - 16443749
Alignment:
| Q |
105 |
caggcactcgatagacttaaaggaaggttccgcccgtaaatttcttgatcaatgttaccgggaagcagcaacagagacagattgagtgctaaagct |
200 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||| || |||| ||||| ||||| || ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16443843 |
caggcacttgattgacttaaaggaaggttccgcc-gttaattgattgattgatgttgccaggaagcagcaacagagacagattgagtactaaagct |
16443749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5428 times since January 2019
Visitors: 5757