View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_41 (Length: 316)
Name: NF0780_low_41
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 105 - 214
Target Start/End: Complemental strand, 29932977 - 29932868
Alignment:
| Q |
105 |
agtgcttctatgagagtaatgtttgttttgagaaacaatttttaaaaatagttataaatataaaaggctgtttcgtaatgatatatgaaagtacaaaatc |
204 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29932977 |
agtgcttctatgagagtaatctttgtttcgagaaacaatttttaaaaatagttataaatataaaaggctgttttgtaatgatatatgaaagtacaaaatc |
29932878 |
T |
 |
| Q |
205 |
acaacagaaa |
214 |
Q |
| |
|
|||||||||| |
|
|
| T |
29932877 |
acaacagaaa |
29932868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University