View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_41 (Length: 316)

Name: NF0780_low_41
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_41
NF0780_low_41
[»] chr7 (1 HSPs)
chr7 (105-214)||(29932868-29932977)


Alignment Details
Target: chr7 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 105 - 214
Target Start/End: Complemental strand, 29932977 - 29932868
Alignment:
105 agtgcttctatgagagtaatgtttgttttgagaaacaatttttaaaaatagttataaatataaaaggctgtttcgtaatgatatatgaaagtacaaaatc 204  Q
    |||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
29932977 agtgcttctatgagagtaatctttgtttcgagaaacaatttttaaaaatagttataaatataaaaggctgttttgtaatgatatatgaaagtacaaaatc 29932878  T
205 acaacagaaa 214  Q
    ||||||||||    
29932877 acaacagaaa 29932868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University