View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_42 (Length: 316)
Name: NF0780_low_42
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 9e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 4 - 204
Target Start/End: Complemental strand, 36998246 - 36998050
Alignment:
Q |
4 |
tatttttaattaaatagaacaatgnnnnnnnnaaggaattaaatagaactaatggtttcgacatagccttcttccaaagaaacattcaaaactgatgagg |
103 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
T |
36998246 |
tatttttaattaaatagaacaatgttttttt-aaggaattaaatagaactaatggtttcgacatagccttcttccaaagaaacgttaaaaactgatgagg |
36998148 |
T |
 |
Q |
104 |
tttgccttagcagcttttcacattaagtccttcaaagccttacctgaaaacagccatatattaatgttagattttacaaccttataatgctcacaggttc |
203 |
Q |
|
|
||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||| |
|
|
T |
36998147 |
tttgccttagcagctttccacattaaatccttcaaagccttacctgaaaacagccatatat---tgttagattttacaaccttattatgctcacagtttc |
36998051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6706 times since January 2019
Visitors: 5770