View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_43 (Length: 313)
Name: NF0780_low_43
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 104 - 235
Target Start/End: Original strand, 27688436 - 27688567
Alignment:
Q |
104 |
aggtgtactaccttacataaaataacgtgtatataccgacgaaacaaatggttaaatatgttcgaattccctacaaatatgcaagcttctgatattaatc |
203 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27688436 |
aggtgtactaccttacataaaataacgtgtatataccgacgaaacaaatggttaaatatgttcgaattccctacaaatatgcaagcttctgatattaatc |
27688535 |
T |
 |
Q |
204 |
cctactttgattgcataaattttttggtcccc |
235 |
Q |
|
|
||||||||||||||||| |||||||||||||| |
|
|
T |
27688536 |
cctactttgattgcatacattttttggtcccc |
27688567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6867 times since January 2019
Visitors: 5772