View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_43 (Length: 313)

Name: NF0780_low_43
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_43
NF0780_low_43
[»] chr7 (1 HSPs)
chr7 (104-235)||(27688436-27688567)


Alignment Details
Target: chr7 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 104 - 235
Target Start/End: Original strand, 27688436 - 27688567
Alignment:
104 aggtgtactaccttacataaaataacgtgtatataccgacgaaacaaatggttaaatatgttcgaattccctacaaatatgcaagcttctgatattaatc 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27688436 aggtgtactaccttacataaaataacgtgtatataccgacgaaacaaatggttaaatatgttcgaattccctacaaatatgcaagcttctgatattaatc 27688535  T
204 cctactttgattgcataaattttttggtcccc 235  Q
    ||||||||||||||||| ||||||||||||||    
27688536 cctactttgattgcatacattttttggtcccc 27688567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6867 times since January 2019
Visitors: 5772