View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_44 (Length: 309)
Name: NF0780_low_44
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 126 - 224
Target Start/End: Original strand, 2263707 - 2263805
Alignment:
Q |
126 |
aactgtcacatcttcatttaacgtgtcatgtcatagtatttaacaattgaacttaatatactgttcaacgaacgaaattgctaattcgtaaaacatata |
224 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
T |
2263707 |
aactgtcacatcttcatttaacgtgtcatgtcatagtatttaacgattgaacttaatgtaatgttcaacgaacgaaattgctaattcgtaaaacatata |
2263805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6692 times since January 2019
Visitors: 5770