View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_47 (Length: 305)
Name: NF0780_low_47
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 2 - 130
Target Start/End: Complemental strand, 8465653 - 8465525
Alignment:
Q |
2 |
gtgattaacaataaacaaacatcataattcataatggtagtaggtgttggatttttgtgctatatttgatacaataagtggctcatttcgatgcttctct |
101 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8465653 |
gtgattaacaataaacaaacatcataattcataatggtagtaggtgttggatttttgtgctatatttgatacaataagtggctcatttcgatgcttctct |
8465554 |
T |
 |
Q |
102 |
cttcatcattcattcactcactctctgtg |
130 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
8465553 |
gttcatcattcattcactcactctctgtg |
8465525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 8465695 - 8465666
Alignment:
Q |
1 |
ggtgattaacaataaacaaacatcataatt |
30 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
8465695 |
ggtgattaacaataaacaaacatcataatt |
8465666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7147 times since January 2019
Visitors: 5774