View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_48 (Length: 301)
Name: NF0780_low_48
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 34416376 - 34416156
Alignment:
Q |
1 |
ttttctataacattagaagcaaacttctgctggctcatctgcactatctgcccagtgaattcctttattatcgcggtacgttcatgtggctttccatgct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34416376 |
ttttctataacattagaagcaaacttctgctggctcatctgcactatctgcccagtgaattcctttattatcgcggtacgttcatgtggctttccatgct |
34416277 |
T |
 |
Q |
101 |
ccagcacatgctgaaaaattttaagcaatcaaacgccaaggaaaattaaaagcacaaaacaaactattactatcatttagtttttacttgaagaaatttc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34416276 |
ccagcacatgctgaaaaattttaagcaatcaaacgccaaggaaaattaaaagcacaaaacaaactattactatcatttagtttttacttgaagaaatttc |
34416177 |
T |
 |
Q |
201 |
ataattaattcagggtttcat |
221 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
34416176 |
ataattaattcagggtttcat |
34416156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6315 times since January 2019
Visitors: 5767