View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_49 (Length: 296)
Name: NF0780_low_49
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_49 |
 |  |
|
[»] scaffold0044 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0044 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 88217 - 88378
Alignment:
Q |
1 |
cgcttcttccatcactttacacacgtcaaatggccgacgaccaaaccaacgtggcttcttctctgccactcacggctgccagtaagaggcagcaattgaa |
100 |
Q |
|
|
|||||||||| ||||||||| |||||||||||||||||||| |||| || |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
88217 |
cgcttcttccgtcactttacgtacgtcaaatggccgacgaccgaaccgacatggcttcttctctgccactcacggctgccactaagaggcagcaattgaa |
88316 |
T |
 |
Q |
101 |
cacctccaccgaaaccctatcatcgtcgctgcttccaactcttccattcgatgtgatctctg |
162 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
88317 |
cacctccaccgaaaccctatcatcgtcgctgcttccaactcttccgttcgatgtgatctctg |
88378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University