View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_52 (Length: 292)
Name: NF0780_low_52
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 13 - 281
Target Start/End: Original strand, 6105726 - 6105994
Alignment:
Q |
13 |
agaacctgtgcggcataacctctctaaaagggggcctgttgcacaaggcttccactaggtggagtctaaagcggagatgctgttttttggatttgaacct |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6105726 |
agaacctgtgcggcataacctctctaaaagggggcctgttgcacaaggcttccactaggtggagtctaaagcggagatgctgttttttggatttgaacct |
6105825 |
T |
 |
Q |
113 |
gtgacatccatcacaaggcaaggcagcaatcttgcctctactttccagttacattctagttcacatacatgtttatttgaaatttgcaggaagttagctc |
212 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
6105826 |
gtgacatccatcacaaggcaaggcagcaatcttgcctctactttccagttacattctagttcacatacatgtttatttgaaacttgcaggaagttagctc |
6105925 |
T |
 |
Q |
213 |
tatgctactggagaaacttgttgctgcaggaattgggaatcgacctgttgtttttgttactcacaggtt |
281 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
6105926 |
tatgctactggagaaacttgttgctgcaggaattgggaatcgacctgttgtttttgttactcataggtt |
6105994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University