View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_60 (Length: 274)

Name: NF0780_low_60
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_60
NF0780_low_60
[»] chr8 (1 HSPs)
chr8 (26-243)||(41173060-41173277)


Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 26 - 243
Target Start/End: Complemental strand, 41173277 - 41173060
Alignment:
26 agcataggcaacttaaaattctggatcgtagctctatcattgccaatctagtaaatgcaatgtctaggggaaaagtggtagaagaatacaaaatgatttg 125  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
41173277 agcataggcaacttaaaattctggatcgtagctctatcattgccaatctagtaaatgcaacgtctaggggaaaagtggtagaagaatacaaaatgatttg 41173178  T
126 cctcacatagagtcatgccaaattgcttgatgacttatactataactannnnnnnnactgcactattaattcaatttaattccattagtcacttttatgg 225  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||        ||||||||||||| ||||||||||||||||||||||||||||||    
41173177 cctcacatagagtcatgccaaattgcttgatgatttatactataactattttttttactgcactattaactcaatttaattccattagtcacttttatgg 41173078  T
226 atttatataaaacacagg 243  Q
    ||||||||||| ||||||    
41173077 atttatataaagcacagg 41173060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University