View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_60 (Length: 274)
Name: NF0780_low_60
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_60 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 26 - 243
Target Start/End: Complemental strand, 41173277 - 41173060
Alignment:
Q |
26 |
agcataggcaacttaaaattctggatcgtagctctatcattgccaatctagtaaatgcaatgtctaggggaaaagtggtagaagaatacaaaatgatttg |
125 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41173277 |
agcataggcaacttaaaattctggatcgtagctctatcattgccaatctagtaaatgcaacgtctaggggaaaagtggtagaagaatacaaaatgatttg |
41173178 |
T |
 |
Q |
126 |
cctcacatagagtcatgccaaattgcttgatgacttatactataactannnnnnnnactgcactattaattcaatttaattccattagtcacttttatgg |
225 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
41173177 |
cctcacatagagtcatgccaaattgcttgatgatttatactataactattttttttactgcactattaactcaatttaattccattagtcacttttatgg |
41173078 |
T |
 |
Q |
226 |
atttatataaaacacagg |
243 |
Q |
|
|
||||||||||| |||||| |
|
|
T |
41173077 |
atttatataaagcacagg |
41173060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University